Top » Catalog » SNPs » A10853

$18.00

A10853
[A10853]

A10853
HG19 Position: ChrY:17886741..17886741
Ancestral: T
Derived: C
Reference: Ron Dryden (2016)
ISOGG Haplogroup: R1b
Comments: Downstream S568
Forward Primer: A10853_F TTGGCAGGCTTCTTTAGTGC
Reverse Primer: A10853_R CTCCAATTGCCTTTCCAATG
Reviews

Customers who bought this product also purchased
A10860
A10860
A10851
A10851
A10857
A10857
Wish a SNP
Wish a SNP
A10856
A10856
A10855
A10855
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies