Top » Catalog » SNPs » A10853

$18.00

A10853
[A10853]

A10853
hg38 Position: ChrY:15774861..15774861
Ancestral: T
Derived: C
Reference: Ron Dryden (2016)
ISOGG Haplogroup: R1b
Comments: Downstream S568
Forward Primer: A10853_F TTGGCAGGCTTCTTTAGTGC
Reverse Primer: A10853_R CTCCAATTGCCTTTCCAATG
Reviews

Customers who bought this product also purchased
A10855
A10855
A10862
A10862
A10854
A10854
A10861
A10861
A10852
A10852
A10860
A10860
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies