Top » Catalog » SNPs » A10855

$18.00

A10855
[A10855]

A10855
HG19 Position: ChrY:17021063..17021063
Ancestral: A
Derived: G
Reference: Ron Dryden (2016)
ISOGG Haplogroup: R1b
Comments: Downstream S568
Forward Primer: A10855_F AATACAATTCCCTTTGCTGTACATG
Reverse Primer: A10855_R ATCCAGACTGGGAAAGATAGTCAG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A10856
A10856
A10854
A10854
A10862
A10862
A10853
A10853
A10861
A10861
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1082
1 x A1148
$36.00
Haplogroup Info
Other products
Currencies