Top » Catalog » SNPs » A10856

$18.00

A10856
[A10856]

A10856
HG19 Position: ChrY:21134760..21134760
Ancestral: T
Derived: G
Reference: Ron Dryden (2016)
ISOGG Haplogroup: R1b
Comments: Downstream S568
Forward Primer: A10856_F ACCATGAAAGTGCTCATCCTATG
Reverse Primer: A10856_R ATGGTGGTAGGCACCTGTATC
Reviews

Customers who bought this product also purchased
A10852
A10852
A10860
A10860
A10851
A10851
A10857
A10857
Wish a SNP
Wish a SNP
A10855
A10855
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies