Top » Catalog » SNPs » A10860

$18.00

A10860
[A10860]

A10860
HG19 Position: ChrY:23052983..23052983
Ancestral: T
Derived: G
Reference: Ron Dryden (2016)
ISOGG Haplogroup: R1b
Comments: Downstream S568
Forward Primer: A10860_F GGAAAATGGACATTTGGCTTC
Reverse Primer: A10860_R GTTATTGGCCAGGTCCAGTG
Reviews

Customers who bought this product also purchased
A10857
A10857
A10851
A10851
A10856
A10856
Wish a SNP
Wish a SNP
A10855
A10855
A10854
A10854
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies