Top » Catalog » SNPs » A10861

$18.00

A10861
[A10861]

A10861
hg38 Position: ChrY:20955524..20955524
Ancestral: C
Derived: G
Reference: Ron Dryden (2016)
ISOGG Haplogroup: R1b
Comments: Downstream S568
Forward Primer: A10861_F GGGCAAGATGTTCCACAATC
Reverse Primer: A10861_R TGCTGTTGAAAGCAAAATGAAC
Reviews

Customers who bought this product also purchased
A10854
A10854
A10862
A10862
A10853
A10853
A10860
A10860
A10852
A10852
A10857
A10857
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies