Top » Catalog » SNPs » A10865

$18.00

A10865
[A10865]

A10865
HG19 Position: ChrY:19222496..19222496
Ancestral: G
Derived: A
Reference: Nigel McCarthery (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream P314 > L362 > ZS4606 > A5813
Forward Primer: A10865_F ATCACTCGATTCCCAACAGC
Reverse Primer: A10865_R CACCCTGACTTCGAGAACG
Reviews

Customers who bought this product also purchased
FTDNA111 to YSEQ116
FTDNA111 to YSEQ116
A10864
A10864
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies