Top » Catalog » SNPs » A10865

$18.00

A10865
[A10865]

A10865
HG19 Position: ChrY:21384382..21384382
Ancestral: G
Derived: A
Reference: Nigel McCarthery (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream P314 > L362 > ZS4606 > A5813
Forward Primer: A10865_F ATCACTCGATTCCCAACAGC
Reverse Primer: A10865_R CACCCTGACTTCGAGAACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies