Top » Catalog » SNPs » A10868

$18.00

A10868
[A10868]

A10868
HG19 Position: ChrY:22009088..22009088
Ancestral: G
Derived: T
Reference: Nigel McCarthery (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream P314 > L362 > ZS4606 > A5813
Forward Primer: A10868_F ACAGAAGGTTGTGCCTGGAG
Reverse Primer: A10868_R AGCATGATTCAGCTTGCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies