Top » Catalog » SNPs » A10870

$17.50

A10870
[A10870]

A10870
HG19 Position: ChrY:16424646..16424646
Ancestral: C
Derived: G
Reference: Edwin Holcombe (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A10870_F CAGATGATCTTGATAGGTACATAGGC
Reverse Primer: A10870_R GCATAAAGGGGCTTGGAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies