Top » Catalog » SNPs » A10870

$18.00

A10870
[A10870]

A10870
HG19 Position: ChrY:14312766..14312766
Ancestral: C
Derived: G
Reference: Edwin Holcombe (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A10870_F CAGATGATCTTGATAGGTACATAGGC
Reverse Primer: A10870_R GCATAAAGGGGCTTGGAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11027
1 x A1165
1 x A10092
$54.00
Haplogroup Info
Other products
Currencies