Top » Catalog » SNPs » A10747

$18.00

A10747
[A10747]

A10747
hg38 Position: ChrY:12444279..12444279
Ancestral: C
Derived: T
Reference: Debra Dunbar Nowell (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S5750 > ZP33
Forward Primer: A10747_F TGCCTGTACACATGCATGTG
Reverse Primer: A10747_R GCATGTGGATTTCATATGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies