Top » Catalog » SNPs » A10750

$17.50

A10750
[A10750]

A10750
HG19 Position: ChrY:7846763..7846763
Ancestral: G
Derived: A
Reference: Debra Dunbar Nowell (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S5750 > ZP33
Forward Primer: A10750_F TCTTTTAGTTGACACCTTTAACTGTTAGC
Reverse Primer: A10750_R GGTGGTACACAGTGTTTTATAACAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies