Top » Catalog » SNPs » A10753

$18.00

A10753
[A10753]

A10753
HG19 Position: ChrY:8858315..8858315
Ancestral: A
Derived: G
Reference: Debra Dunbar Nowell (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S5750 > ZP90
Forward Primer: A10753_F TGCATTTTATGAAAAGGAAATCTTC
Reverse Primer: A10753_R GAACAAATAGGCAAAAATTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11673
1 x A10547
1 x A11254
1 x A10989
1 x A10747
$90.00
Haplogroup Info
Other products
Currencies