Top » Catalog » SNPs » A10754

$18.00

A10754
[A10754]

A10754
HG19 Position: ChrY:18398895..18398895
Ancestral: G
Derived: A
Reference: Debra Dunbar Nowell (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S5750 > ZP90
Forward Primer: A10754_F TGTAAAGATATCTGTATTCCTATGTTCACTG
Reverse Primer: A10754_R GTATGTTGATAGATGTAGATAGATAAGCTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies