Top » Catalog » SNPs » A10755

$17.50

A10755
[A10755]

A10755
HG19 Position: ChrY:23963426..23963426
Ancestral: T
Derived: G
Reference: Debra Dunbar Nowell (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S5750 > ZP90
Forward Primer: A10755_F AAACAAATTAGGCTCTGCAAGC
Reverse Primer: A10755_R ACCATGAGGTGGTATTTACAAATATTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies