Top » Catalog » SNPs » A10884

$18.00

A10884
[A10884]

A10884
HG19 Position: ChrY:17144885..17144885
Ancestral: T
Derived: C
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1a1a1b1a3a1a1a (not listed)
Comments: Below YP4957.
Forward Primer: A10884_F TGCAGAGGAAGCCTTTAGGTAG
Reverse Primer: A10884_R GCAAAGCCCACAGAATTACTC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
YP4958
YP4958
YP4957
YP4957
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1001
1 x A11645
$36.00
Haplogroup Info
Other products
Currencies