Top » Catalog » SNPs » A10872

$18.00

A10872
[A10872]

A10872
HG19 Position: ChrY:17001967..17001967
Ancestral: C
Derived: A
Reference: JB Royal (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of DF27
Forward Primer: A10872_F TCATCACCACCATCTTTTGG
Reverse Primer: A10872_R TCCTGGGTTGACCTTTGTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10721
1 x A11672
1 x A10952
1 x A11248
$72.00
Haplogroup Info
Other products
Currencies