Top » Catalog » SNPs » A10873

$18.00

A10873
[A10873]

A10873
hg38 Position: ChrY:17227752..17227752
Ancestral: G
Derived: A
Reference: JB Royal (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of DF27
Forward Primer: A10873_F ATTAACTATAATCACCGTGAGTACAATAGAG
Reverse Primer: A10873_R GCATCTCTCTAATGAAAGAAAGACATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies