Top » Catalog » SNPs » A10877

$18.00

A10877
[A10877]

A10877
HG19 Position: ChrY:6931406..6931406
Ancestral: C
Derived: A
Reference: JB Royal (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of DF27
Forward Primer: A10877_F CAGGTTATTCCTCGCACAGG
Reverse Primer: A10877_R TGCCATAACCATTTTTCGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies