Top » Catalog » SNPs » A10880

$18.00

A10880
[A10880]

A10880
HG19 Position: ChrY:16731385..16731385
Ancestral: C
Derived: T
Reference: JB Royal (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of DF27
Forward Primer: A10880_F TGAGCTGTCTGTTTCAGCAAC
Reverse Primer: A10880_R TGTGAACTGAGGGAAGCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies