Top » Catalog » SNPs » A10929

$18.00

A10929
[A10929]

A10929
hg38 Position: ChrY:8648777..8648777
Ancestral: A
Derived: G
Reference: James Royal (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27
Forward Primer: A10929_F GTATCAGAAAGCCCAGTTGAGG
Reverse Primer: A10929_R GCAACCATGGTAGAAGCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies