Top » Catalog » SNPs » A10931

$17.50

A10931
[A10931]

A10931
HG19 Position: ChrY:16579799..16579799
Ancestral: A
Derived: C
Reference: James Royal (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27
Forward Primer: A10931_F GAACTCATTCTGATGCAATTCTG
Reverse Primer: A10931_R GAAGAATTATGAGTGGGCCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies