Top » Catalog » SNPs » A10933

$18.00

A10933
[A10933]

A10933
HG19 Position: ChrY:19596698..19596698
Ancestral: G
Derived: T
Reference: James Royal (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27
Forward Primer: A10933_F TGCCAGTTATTAGGCAAGATAGG
Reverse Primer: A10933_R GAGAGGCTTGAATGAGAAAACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11673
1 x A10547
$36.00
Haplogroup Info
Other products
Currencies