Top » Catalog » SNPs » A10935

$18.00

A10935
[A10935]

A10935
HG19 Position: ChrY:20907088..20907088
Ancestral: A
Derived: G
Reference: James Royal (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27
Forward Primer: A10935_F TGAATGCAATCCTTATTAACACAAAC
Reverse Primer: A10935_R TCCTGAATTTAATTGCCATCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10062
$18.00
Haplogroup Info
Other products
Currencies