Top » Catalog » SNPs » A10525

$18.00

A10525
[A10525]

A10525
HG19 Position: ChrY:7206305..7206305
Ancestral: C
Derived: A
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF49 > A260
Forward Primer: A10525_F CCATTTTGGATGGGCTAGC
Reverse Primer: A10525_R GCAGGCTCTGGGAGATACAAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies