Top » Catalog » SNPs » A10525

$18.00

A10525
[A10525]

A10525
HG19 Position: ChrY:7206305..7206305
Ancestral: C
Derived: A
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF49 > A260
Forward Primer: A10525_F CCATTTTGGATGGGCTAGC
Reverse Primer: A10525_R GCAGGCTCTGGGAGATACAAG
Reviews

Customers who bought this product also purchased
A5902
A5902
S588
S588
A883
A883
DF85
DF85
FGC5939.2
FGC5939.2
DF105
DF105
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies