Top » Catalog » SNPs » A10525

$18.00

A10525
[A10525]

A10525
HG19 Position: ChrY:7338264..7338264
Ancestral: C
Derived: A
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF49 > A260
Forward Primer: A10525_F CCATTTTGGATGGGCTAGC
Reverse Primer: A10525_R GCAGGCTCTGGGAGATACAAG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
BY18114
BY18114
FGC5939.2
FGC5939.2
DF105
DF105
FGC4133
FGC4133
A260
A260
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10999
1 x A11746
1 x A10113
1 x A11687
1 x A10589
1 x A11649
1 x A1073
1 x A10922
1 x A10852
1 x A11367
$180.00
Haplogroup Info
Other products
Currencies