Top » Catalog » SNPs » A10525

$18.00

A10525
[A10525]

A10525
HG19 Position: ChrY:7338264..7338264
Ancestral: C
Derived: A
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF49 > A260
Forward Primer: A10525_F CCATTTTGGATGGGCTAGC
Reverse Primer: A10525_R GCAGGCTCTGGGAGATACAAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10882
1 x A11414
1 x A11530
1 x A10539
1 x A10529
1 x A11381
1 x A10605
$126.00
Haplogroup Info
Other products
Currencies