Top » Catalog » SNPs » A10525

$18.00

A10525
[A10525]

A10525
hg38 Position: ChrY:7338264..7338264
Ancestral: C
Derived: A
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF49 > A260
Forward Primer: A10525_F CCATTTTGGATGGGCTAGC
Reverse Primer: A10525_R GCAGGCTCTGGGAGATACAAG
Reviews

Customers who bought this product also purchased
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
A259
A259
FGC42414
FGC42414
A223
A223
A5902
A5902
S588
S588
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11610
$18.00
Haplogroup Info
Other products
Currencies