Top » Catalog » SNPs » A10896

$18.00

A10896
[A10896]

A10896
HG19 Position: ChrY:12645736..12645736
Ancestral: C
Derived: A
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10896_F TTAAAAGCAGTTCTAAATCTTAAAGCAC
Reverse Primer: A10896_R TGCAGTGAGCTGACATCATG
Reviews

Customers who bought this product also purchased
A10892
A10892
YFS1390487
YFS1390487
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
A10891
A10891
A10899
A10899
A10890
A10890
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10162
1 x A10732
1 x A11279
1 x A10260
1 x A11514
1 x A10161
1 x A10731
$126.00
Haplogroup Info
Other products
Currencies