Top » Catalog » SNPs » A10896

$18.00

A10896
[A10896]

A10896
hg38 Position: ChrY:12645736..12645736
Ancestral: C
Derived: A
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10896_F TTAAAAGCAGTTCTAAATCTTAAAGCAC
Reverse Primer: A10896_R TGCAGTGAGCTGACATCATG
Reviews

Customers who bought this product also purchased
A10897
A10897
A10889
A10889
A10894
A10894
YFS1390401
YFS1390401
A10888
A10888
A10893
A10893
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies