Top » Catalog » SNPs » A10896

$18.00

A10896
[A10896]

A10896
HG19 Position: ChrY:14757667..14757667
Ancestral: C
Derived: A
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10896_F TTAAAAGCAGTTCTAAATCTTAAAGCAC
Reverse Primer: A10896_R TGCAGTGAGCTGACATCATG
Reviews

Customers who bought this product also purchased
YFS1390401
YFS1390401
A10888
A10888
A10893
A10893
YFS1390488
YFS1390488
A10887
A10887
A10892
A10892
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies