Top » Catalog » SNPs » A10951

$18.00

A10951
[A10951]

A10951
HG19 Position: ChrY:15465680..15465680
Ancestral: ins
Derived: del
Reference: Paul Mize (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27
Forward Primer: A10951_F TCAGTCATTCAACATGTCATTAAGG
Reverse Primer: A10951_R TCAAAGTTAGAGTCAATCCTCTTGAAC
Reviews

Customers who bought this product also purchased
A450
A450
A435
A435
A5581
A5581
A443
A443
A449
A449
A434
A434
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies