Top » Catalog » SNPs » A10951

$18.00

A10951
[A10951]

A10951
hg38 Position: ChrY:13353800..13353800
Ancestral: ins
Derived: del
Reference: Paul Mize (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27
Forward Primer: A10951_F TCAGTCATTCAACATGTCATTAAGG
Reverse Primer: A10951_R TCAAAGTTAGAGTCAATCCTCTTGAAC
Reviews

Customers who bought this product also purchased
A434
A434
A5580
A5580
A442
A442
A447
A447
A433
A433
A5579
A5579
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies