Top » Catalog » SNPs » A10951

$18.00

A10951
[A10951]

A10951
HG19 Position: ChrY:13353800..13353800
Ancestral: ins
Derived: del
Reference: Paul Mize (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27
Forward Primer: A10951_F TCAGTCATTCAACATGTCATTAAGG
Reverse Primer: A10951_R TCAAAGTTAGAGTCAATCCTCTTGAAC
Reviews

Customers who bought this product also purchased
A445
A445
R1b-DF27 Rucker Panel
R1b-DF27 Rucker Panel
A451
A451
A436
A436
A790
A790
A444
A444
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10926
1 x A10111
1 x A11627
$54.00
Haplogroup Info
Other products
Currencies