Top » Catalog » SNPs » A10888

$18.00

A10888
[A10888]

A10888
HG19 Position: ChrY:22689413..22689413
Ancestral: T
Derived: C
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10888_F CCAGGAGGCAGAGGTTTTAG
Reverse Primer: A10888_R CTCTGTAGCTGTACCGATGAGAAAC
Reviews

Customers who bought this product also purchased
A10892
A10892
A10899
A10899
A10891
A10891
A10897
A10897
A10890
A10890
A10896
A10896
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies