Top » Catalog » SNPs » A10888

$18.00

A10888
[A10888]

A10888
HG19 Position: ChrY:20527527..20527527
Ancestral: T
Derived: C
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10888_F CCAGGAGGCAGAGGTTTTAG
Reverse Primer: A10888_R CTCTGTAGCTGTACCGATGAGAAAC
Reviews

Customers who bought this product also purchased
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
A10892
A10892
A10899
A10899
A10891
A10891
A10897
A10897
A10890
A10890
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10666
1 x A10513
1 x A10944
1 x A11368
1 x A10111
$90.00
Haplogroup Info
Other products
Currencies