Top » Catalog » SNPs » A10889

$17.50

A10889
[A10889]

A10889
HG19 Position: ChrY:23631786..23631786
Ancestral: T
Derived: G
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10889_F GAAACATCAGGAATGACTCTGG
Reverse Primer: A10889_R TCTCAGTGAGTCTGGACATGC
Reviews

Customers who bought this product also purchased
A10893
A10893
YFS1390487
YFS1390487
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
A10892
A10892
A10899
A10899
A10891
A10891
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies