Top » Catalog » SNPs » A10889

$18.00

A10889
[A10889]

A10889
hg38 Position: ChrY:21469900..21469900
Ancestral: T
Derived: G
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10889_F GAAACATCAGGAATGACTCTGG
Reverse Primer: A10889_R TCTCAGTGAGTCTGGACATGC
Reviews

Customers who bought this product also purchased
A10897
A10897
A10890
A10890
A10896
A10896
YFS1390401
YFS1390401
A10888
A10888
A10894
A10894
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies