Top » Catalog » SNPs » A10890

$18.00

A10890
[A10890]

A10890
hg38 Position: ChrY:16559530..16559530
Ancestral: C
Derived: A
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10890_F CTGAATGGGTGAACCACCTC
Reverse Primer: A10890_R AGGAGTTTGATGCTGCAGTG
Reviews

Customers who bought this product also purchased
A10892
A10892
A10899
A10899
A10891
A10891
A10897
A10897
A10889
A10889
A10896
A10896
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies