Top » Catalog » SNPs » A10890

$18.00

A10890
[A10890]

A10890
HG19 Position: ChrY:16559530..16559530
Ancestral: C
Derived: A
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10890_F CTGAATGGGTGAACCACCTC
Reverse Primer: A10890_R AGGAGTTTGATGCTGCAGTG
Reviews

Customers who bought this product also purchased
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
A10892
A10892
A10899
A10899
A10891
A10891
A10897
A10897
A10889
A10889
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11239
1 x A10327
1 x A10614
1 x A11553
$72.00
Haplogroup Info
Other products
Currencies