Top » Catalog » SNPs » A10891

$18.00

A10891
[A10891]

A10891
HG19 Position: ChrY:7284483..7284483
Ancestral: G
Derived: A
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10891_F GGTCTTGCAGAGCATGGTG
Reverse Primer: A10891_R GAGGCCTTAGGAGGAACCAG
Reviews

Customers who bought this product also purchased
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
A10892
A10892
A10899
A10899
A10890
A10890
A10897
A10897
A10889
A10889
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11525
1 x A11668
1 x A10984
1 x A10032
$72.00
Haplogroup Info
Other products
Currencies