Top » Catalog » SNPs » A10891

$18.00

A10891
[A10891]

A10891
HG19 Position: ChrY:7284483..7284483
Ancestral: G
Derived: A
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10891_F GGTCTTGCAGAGCATGGTG
Reverse Primer: A10891_R GAGGCCTTAGGAGGAACCAG
Reviews

Customers who bought this product also purchased
A10888
A10888
A10894
A10894
YFS1390488
YFS1390488
A10887
A10887
A10893
A10893
YFS1390487
YFS1390487
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies