Top » Catalog » SNPs » A10891

$18.00

A10891
[A10891]

A10891
hg38 Position: ChrY:7284483..7284483
Ancestral: G
Derived: A
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10891_F GGTCTTGCAGAGCATGGTG
Reverse Primer: A10891_R GAGGCCTTAGGAGGAACCAG
Reviews

Customers who bought this product also purchased
A10894
A10894
YFS1390488
YFS1390488
A10887
A10887
A10893
A10893
YFS1390487
YFS1390487
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies