Top » Catalog » SNPs » A10892

$18.00

A10892
[A10892]

A10892
HG19 Position: ChrY:15359336..15359336
Ancestral: C
Derived: T
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10892_F CATTTATTTGATCTGCAGGTCTTG
Reverse Primer: A10892_R TGAAATAAAATTCCTGCATTACTCAG
Reviews

Customers who bought this product also purchased
A10887
A10887
A10893
A10893
YFS1390487
YFS1390487
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
A10891
A10891
A10899
A10899
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10278
1 x A11487
1 x A1153
1 x A11162
1 x A11661
$90.00
Haplogroup Info
Other products
Currencies