Top » Catalog » SNPs » A10893

$18.00

A10893
[A10893]

A10893
hg38 Position: ChrY:13759577..13759577
Ancestral: T
Derived: C
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10893_F AAGGGATTCTTTTCCCTTGG
Reverse Primer: A10893_R CTGGCACAGTGGCTTACACC
Reviews

Customers who bought this product also purchased
A10899
A10899
A10890
A10890
A10897
A10897
A10889
A10889
A10896
A10896
YFS1390401
YFS1390401
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies