Top » Catalog » SNPs » A10893

$18.00

A10893
[A10893]

A10893
HG19 Position: ChrY:13759577..13759577
Ancestral: T
Derived: C
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10893_F AAGGGATTCTTTTCCCTTGG
Reverse Primer: A10893_R CTGGCACAGTGGCTTACACC
Reviews

Customers who bought this product also purchased
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
A10891
A10891
A10899
A10899
A10890
A10890
A10897
A10897
A10889
A10889
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10891
$18.00
Haplogroup Info
Other products
Currencies