Top » Catalog » SNPs » A10897

$18.00

A10897
[A10897]

A10897
HG19 Position: ChrY:9462741..9462741
Ancestral: A
Derived: C
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10897_F CACAGGGCTGCTGTACCC
Reverse Primer: A10897_R CTTTGTCTCTGTCTGGCATGG
Reviews

Customers who bought this product also purchased
YFS1390487
YFS1390487
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
A10891
A10891
A10899
A10899
A10890
A10890
A10896
A10896
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies