Top » Catalog » SNPs » A10897

$18.00

A10897
[A10897]

A10897
HG19 Position: ChrY:9625132..9625132
Ancestral: A
Derived: C
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10897_F CACAGGGCTGCTGTACCC
Reverse Primer: A10897_R CTTTGTCTCTGTCTGGCATGG
Reviews

Customers who bought this product also purchased
A10893
A10893
YFS1390488
YFS1390488
A10887
A10887
A10892
A10892
YFS1390487
YFS1390487
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11620
1 x A10721
1 x A11629
1 x A11218
1 x A10657
1 x A10540
1 x A10503
$126.00
Haplogroup Info
Other products
Currencies