Top » Catalog » SNPs » A10899

$18.00

A10899
[A10899]

A10899
hg38 Position: ChrY:19232925..19232925
Ancestral: T
Derived: A
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10899_F TGCACTTCCTGTTTGAGGTG
Reverse Primer: A10899_R CAAAGGTCTGGATTGCCTTG
Reviews

Customers who bought this product also purchased
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
A10891
A10891
A10897
A10897
A10890
A10890
A10896
A10896
A10889
A10889
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies