Top » Catalog » SNPs » A10251

$18.00

A10251
[A10251]

A10251
HG19 Position: ChrY:12977400..12977400
Ancestral: C
Derived: T
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-Z138 S6270+ S6275+
Forward Primer: A10251_F CAGGAGTGAGGGGTTCTCTG
Reverse Primer: A10251_R TTGCCTCATGTATTTGATGCTC
Reviews

Customers who bought this product also purchased
A10250
A10250
A10248
A10248
A10246
A10246
A10253
A10253
A10252
A10252
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10165
1 x A10463
1 x A10760
1 x A10862
$72.00
Haplogroup Info
Other products
Currencies