Top » Catalog » SNPs » A10252

$18.00

A10252
[A10252]

A10252
HG19 Position: ChrY:15970116..15970116
Ancestral: G
Derived: T
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-Z138 S6270+ S6275+
Forward Primer: A10252_F TGGTTTGTGCTTTTAGTTCTATTTTG
Reverse Primer: A10252_R CAAGGCATCTGAAAGGAAGTTATAC
Reviews

Customers who bought this product also purchased
A10246
A10246
A10253
A10253
A10251
A10251
A10250
A10250
A10248
A10248
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies