Top » Catalog » SNPs » A10253

$18.00

A10253
[A10253]

A10253
hg38 Position: ChrY:16627100..16627100
Ancestral: A
Derived: G
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-Z138 S6270+ S6275+
Forward Primer: A10253_F CAGCTTTCCAGGCTCGTAAAC
Reverse Primer: A10253_R GTGAGGACTGCCACTATTCCC
Reviews

Customers who bought this product also purchased
A10252
A10252
A10251
A10251
A10250
A10250
A10248
A10248
A10246
A10246
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies