Top » Catalog » SNPs » A10255

$18.00

A10255
[A10255]

A10255
hg38 Position: ChrY:19406336..19406336
Ancestral: G
Derived: A
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-Z138 S6270+ S6275+
Forward Primer: A10255_F TTGTGCCACAGCTCTTTCAG
Reverse Primer: A10255_R CACACACTTCCTCCCCTCTG
Reviews

Customers who bought this product also purchased
A10257
A10257
A10254
A10254
A10259
A10259
A10258
A10258
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies