Top » Catalog » SNPs » A10257

$17.50

A10257
[A10257]

A10257
HG19 Position: ChrY:22886189..22886189
Ancestral: C
Derived: A
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-Z138 S6270+ S6275+
Forward Primer: A10257_F GAAATTTGTTTGGTCCAGAAAAG
Reverse Primer: A10257_R ATTGTTATGGAGTGTTTTACCCG
Reviews

Customers who bought this product also purchased
A10258
A10258
A10255
A10255
A10254
A10254
A10259
A10259
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies